Sample ID: VE25-1425_28S
[analysis description + link to github repo]
| Facility | Hogwarts |
| Analyst | John Doe |
| Analysis started | 2025-05-03 01:28:04 |
| Analysis completed | 2025-05-03 01:28:04 |
| Wall time | 0:0:0 hours |
Pseudococcus longispinus
Outcome: Positive species identification.
Reasoning: [Flag 1A] 1 candidate species matched with high stringency (identity ≥ 98.5%).
| Preliminary morphology ID confirmed? | True |
|
Flag 7A: Identified species is consistent with preliminary morphology ID Pseudococcidae. |
This Preliminary Morphology ID has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error).
For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
None
No database coverage information is available for this taxon. This is likely because the data are insufficient or inappropriate for this analysis, or because an error was encountered during the analysis.
| Taxa of interest detected? | True |
|
Flag 2A: Taxon of interest detected in candidate species Flag 5.1C: The given locus for this taxon is not present in reference database (0 entries) Flag 5.2C: ≤10% of taxon have reference sequence(s) at the given locus |
|
| Locus | 28S rRNA gene |
| Preliminary ID | Pseudococcidae |
| Taxa of interest |
Pseudococcus longispinus |
| Country | New Zealand |
| Host | Blueberries |
| Sample ID | VE25-1425_28S |
| Query DNA sequence |
>VE25-1425_28S CCGTTCGGGGGTAAACGGACAGAGCCCGTGAATCCGGGCGACGGAATTCAGAATCGACGG CGTTCGCGCGTCGTCGGTTCGATATTTCCGCCGCCGCTCAATTTAACGGACGTCGCGACC CGTTCGGTGTCGGTCTGCAGGAGACGTGCGAAAGTTCGTGGGCGTCGGTCGGGTTTCGGC TCGGTCGGCGTTCGCGAGTGCGCGTTTTTTTTCTGGCCGACTCGCCGGACGGTAAGCGAA GCGGTGGTCGCGGCGGCCTCTTGTTAGCGCCGTCGCGAGACCGGTCTGCGACGAATCTTC GGGCCTCTTTCCGACCCGTCTTGAAACACGGACCAAGGAGTCTAACGTGCGCGCGAGTCG CGGGGTGTCGAGCGGCTGGCGGCGTTCGTTCGCGGGCGTCGTCGGCCGTTCGTTACAATA CGAAACCCGTCTCGTTTTACGAAAGGCGCAATGAAAGTGAATTTTGGGGAAGATGACGTT ACCGAGTTCACGTTCCGCGCTCTCGAAGCGCGGCCGGTCGTCCGCATTCCCAGGGCGTCC CAATGGCCCGGCGGCGTTGCGGATCGTCGTTCCTTCGGGGGCGGCGGTCGGGCGTCGTCG AACCGGGGCGCACCTACAGCGTGCACGTTGGTACCCGAAAGATGGTGAACTATGCCCGGC CAGGATGAAGTCAGGGGAAACCCTGATGGAGGTCCGCAGCGATTCTGACGTGCAAATCGA TCGTCTGAGCTGGGTATAGGGGCGAAAGACTAATCGAACCATCCCCC
Flag 1A:
Positive species identification
-
Pseudococcus longispinus
1 candidate species matched with high stringency (identity ≥ 98.5%)
Candidate hits must meet ONE of these criteria:
| Minimum alignment length |
400bp
|
| Minimum query coverage |
85.0%
|
Candidate hits have then been classified as follows:
| Classification | Alignment identity | Number of hits | Number of species |
|---|---|---|---|
| STRONG MATCH | ≥ 98.5% | 7 | 1 |
| MODERATE MATCH | ≥ 93.5% | NA | NA |
| NO MATCH | < 93.5% |
| Species | Hits | Identity | E-value | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Pseudococcus longispinus | 7 | 100.0% | 0.0 |
Database coverage of Candidate Pseudococcus longispinusThis Candidate has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Database coverage of Pseudococcus longispinus
Flag 5.1C:
The reference data are likely to be unreliable for this species
0 records
There are 0 sequences in the reference database for Pseudococcus longispinus at the given locus 28S rRNA gene.
Global occurrence records for Pseudococcus longispinus.
Database coverage of species in genus Pseudococcus
Flag 5.2C:
The reference data offers little support for species in this genus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus 28S rRNA gene Database coverage of species in genus Pseudococcus that occur in country of origin New Zealand
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample’s country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus 28S rRNA gene |
| # | Accession | Hit subject | Align length | Query coverage | Bitscore | E-value | Identity |
|---|---|---|---|---|---|---|---|
| 1 | KT199048 | Pseudococcus longispinus 28S ribosomal RNA gene, partial sequence | 716 | 93.4% | 1419.79 | 0.00e+00 | 100.0% |
| 2 | JQ651177 | Pseudococcus longispinus voucher ARCPPRI SB54_2 28S ribosomal RNA gene, partial sequence | 697 | 90.9% | 1382.13 | 0.00e+00 | 100.0% |
| 3 | JQ651179 | Pseudococcus longispinus voucher ARCPPRI SB54_4 28S ribosomal RNA gene, partial sequence | 681 | 88.8% | 1350.41 | 0.00e+00 | 100.0% |
| 4 | JQ651176 | Pseudococcus longispinus voucher ARCPPRI SB54_1 28S ribosomal RNA gene, partial sequence | 674 | 87.9% | 1336.54 | 0.00e+00 | 100.0% |
| 5 | KY565034 | Pseudococcus longispinus haplotype 9 28S ribosomal RNA gene, partial sequence | 565 | 73.7% | 1120.47 | 0.00e+00 | 100.0% |
| 6 | JQ651178 | Pseudococcus longispinus voucher ARCPPRI SB54_3 28S ribosomal RNA gene, partial sequence | 561 | 73.1% | 1112.54 | 0.00e+00 | 100.0% |
| 7 | MG866179 | Pseudococcus longispinus clone 2-28S 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 622.923 | 1.91e-173 | 100.0% |
| 8 | GU134657 | Pseudococcus longispinus haplotype H1 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 622.923 | 1.91e-173 | 100.0% |
| 9 | AY179456 | Pseudococcus longispinus 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 614.994 | 4.67e-171 | 99.7% |
| 10 | KP692428 | Pseudococcus longispinus isolate S3-800a 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1423.76 | 0.00e+00 | 99.5% |
| 11 | GU134656 | Pseudococcus nr. microadonidum TM-2009 haplotype H1 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 599.136 | 2.77e-166 | 99.0% |
| 12 | MW542049 | Pseudococcus longispinus voucher 180412-JY-05(IN20) large subunit ribosomal RNA gene, partial sequence | 748 | 97.5% | 1340.5 | 0.00e+00 | 97.9% |
| 13 | ON787843 | Phenacoccus solani voucher MNH 01 large subunit ribosomal RNA gene, partial sequence | 439 | 57.2% | 797.362 | 0.00e+00 | 97.9% |
| 14 | KP692436 | Pseudococcus sp. S3-155a 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1330.59 | 0.00e+00 | 97.8% |
| 15 | KP692269 | Dysmicoccus alazon isolate S3-135a 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1312.75 | 0.00e+00 | 97.6% |
| 16 | KP692286 | Euripersia pennisetus isolate S3-590a 28S ribosomal RNA gene, partial sequence | 310 | 40.4% | 552.053 | 4.13e-152 | 97.4% |
| 17 | KP692331 | Palmicultor lumpurensis isolate S4-203 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1294.91 | 0.00e+00 | 97.3% |
| 18 | KR340586 | Dysmicoccus lavandulae voucher 5690 28S ribosomal RNA gene, partial sequence | 762 | 99.3% | 1336.54 | 0.00e+00 | 97.1% |
| 19 | KP692329 | Palmicultor lumpurensis isolate S3-734 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1286.98 | 0.00e+00 | 97.1% |
| 20 | AY427335 | Pseudococcus calceolariae 28S large subunit ribosomal RNA gene, partial sequence | 314 | 40.9% | 549.579 | 2.29e-151 | 97.1% |
| 21 | MW542024 | Heliococcus kurilensis voucher 180518-JY-08(IN60) large subunit ribosomal RNA gene, partial sequence | 346 | 45.1% | 607.556 | 8.09e-169 | 97.1% |
| 22 | MG866178 | Pseudococcus calceolariae clone 1-28S 28S ribosomal RNA gene, partial sequence | 311 | 40.5% | 537.685 | 8.73e-148 | 96.8% |
| 23 | KP692343 | Paraputo sp. 2 XBW-2015 isolate S4-209 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1259.23 | 0.00e+00 | 96.6% |
| 24 | ON787839 | Ferrisia virgata voucher JT 02 large subunit ribosomal RNA gene, partial sequence | 435 | 56.7% | 745.823 | 0.00e+00 | 96.6% |
| 25 | KP692464 | Trionymus perrisii isolate S3-621a 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1257.25 | 0.00e+00 | 96.5% |
| 26 | KY565030 | Pseudococcus meridionalis haplotype 5 28S ribosomal RNA gene, partial sequence | 737 | 96.1% | 1253.28 | 0.00e+00 | 96.5% |
| 27 | KP692282 | Trionymus multivorus isolate S3-598 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1251.3 | 0.00e+00 | 96.5% |
| 28 | KP692345 | Paraputo sp. 2 XBW-2015 isolate S4-211 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1251.3 | 0.00e+00 | 96.5% |
| 29 | JX499999 | Planococcus citri voucher ARC-PPRI SB32.4 28S ribosomal RNA gene, partial sequence | 440 | 57.4% | 745.823 | 0.00e+00 | 96.4% |
| 30 | ON787835 | Coccidohystrix insolita voucher JT 05 a large subunit ribosomal RNA gene, partial sequence | 439 | 57.2% | 743.841 | 0.00e+00 | 96.4% |
| 31 | JX500005 | Pseudococcus viburni voucher ARC-PPRI SB265.1 28S ribosomal RNA gene, partial sequence | 663 | 86.4% | 1120.47 | 0.00e+00 | 96.3% |
| 32 | KY565027 | Pseudococcus sp. FP-2017 haplotype 2 28S ribosomal RNA gene, partial sequence | 646 | 84.2% | 1092.72 | 0.00e+00 | 96.3% |
| 33 | ON787846 | Planococcus minor voucher JT 08 large subunit ribosomal RNA gene, partial sequence | 436 | 56.8% | 737.894 | 0.00e+00 | 96.3% |
| 34 | KY565031 | Pseudococcus viburni haplotype 6 28S ribosomal RNA gene, partial sequence | 762 | 99.3% | 1283.02 | 0.00e+00 | 96.2% |
| 35 | KY565033 | Pseudococcus viburni haplotype 8 28S ribosomal RNA gene, partial sequence | 762 | 99.3% | 1283.02 | 0.00e+00 | 96.2% |
| 36 | KU499443 | Pseudococcus viburni isolate M28S-03 28S ribosomal RNA gene, partial sequence | 760 | 99.1% | 1279.05 | 0.00e+00 | 96.2% |
| 37 | KU499442 | Pseudococcus cryptus isolate M28S-02 28S ribosomal RNA gene, partial sequence | 760 | 99.1% | 1279.05 | 0.00e+00 | 96.2% |
| 38 | MW542048 | Pseudococcus jackbeardsleyi voucher 141026-LAO-08(IN87) large subunit ribosomal RNA gene, partial sequence | 753 | 98.2% | 1247.34 | 0.00e+00 | 96.2% |
| 39 | KP692340 | Paraputo sp. 1 XBW-2015 isolate S4-267a 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1237.42 | 0.00e+00 | 96.2% |
| 40 | KP692427 | Pseudococcus cryptus isolate S3-866 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1235.44 | 0.00e+00 | 96.2% |
| 41 | KP692438 | Pseudococcus viburni isolate S3-050 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1235.44 | 0.00e+00 | 96.2% |
| 42 | KP692253 | Coccura suwakoensis isolate S3-622 28S ribosomal RNA gene, partial sequence | 365 | 47.6% | 617.9602 | 5.97e-172 | 96.2% |
| 43 | KP692439 | Pseudococcus viburni isolate S3-223 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1227.51 | 0.00e+00 | 96.1% |
| 44 | KP692426 | Pseudococcus cryptus isolate S3-179 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1227.51 | 0.00e+00 | 96.1% |
| 45 | KY211358 | Pseudococcus cryptus isolate S5-158 28S ribosomal RNA gene, partial sequence | 723 | 94.3% | 1213.64 | 0.00e+00 | 96.1% |
| 46 | MK873091 | Pseudococcus cryptus voucher LL2 large subunit ribosomal RNA gene, partial sequence | 719 | 93.7% | 1205.71 | 0.00e+00 | 96.1% |
| 47 | ON787836 | Planococcus lilacinus voucher MN 02 b large subunit ribosomal RNA gene, partial sequence | 438 | 57.1% | 733.929 | 0.00e+00 | 96.1% |
| 48 | KY565026 | Pseudococcus sociabilis haplotype 1 28S ribosomal RNA gene, partial sequence | 762 | 99.3% | 1267.16 | 0.00e+00 | 96.0% |
| 49 | ON527954 | Dysmicoccus kunaw voucher H122 large subunit ribosomal RNA gene, partial sequence | 640 | 83.4% | 1064.97 | 0.00e+00 | 96.0% |
| 50 | JX500007 | Pseudococcus viburni voucher ARC-PPRI SB265.3 28S ribosomal RNA gene, partial sequence | 706 | 92.0% | 1172.01 | 0.00e+00 | 95.9% |
| 51 | JX500008 | Pseudococcus viburni voucher ARC-PPRI SB265.5 28S ribosomal RNA gene, partial sequence | 699 | 91.1% | 1158.13 | 0.00e+00 | 95.9% |
| 52 | JQ664014 | Pseudococcus viburni voucher ARC-PPRI SB265.4 28S ribosomal RNA gene, partial sequence | 605 | 78.9% | 1005.5 | 0.00e+00 | 95.9% |
| 53 | KP692462 | Sinococcus ulmi isolate S3-554 28S ribosomal RNA gene, partial sequence | 317 | 41.3% | 526.284 | 2.36e-144 | 95.9% |
| 54 | KP692241 | Coccura convexa isolate S3-616 28S ribosomal RNA gene, partial sequence | 365 | 47.6% | 610.0312 | 1.45e-169 | 95.9% |
| 55 | KP692250 | Coccura suwakoensis isolate S3-553a 28S ribosomal RNA gene, partial sequence | 365 | 47.6% | 610.0312 | 1.45e-169 | 95.9% |
| 56 | MW542031 | Palmicultor lumpurensis voucher IN113 large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 1229.5 | 0.00e+00 | 95.7% |
| 57 | KP692421 | Pseudococcus cryptus isolate S3-350 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1203.73 | 0.00e+00 | 95.7% |
| 58 | ON787842 | Planococcus minor voucher JT 06 b large subunit ribosomal RNA gene, partial sequence | 437 | 57.0% | 718.071 | 0.00e+00 | 95.7% |
| 59 | MW542015 | Coccidohystrix insolita voucher 180527-MY-14(IN59) large subunit ribosomal RNA gene, partial sequence | 438 | 57.1% | 719.0553 | 2.20e-202 | 95.7% |
| 60 | JQ651375 | Pseudococcus viburni voucher ARCPPRI SB292_4 28S ribosomal RNA gene, partial sequence | 654 | 85.3% | 1068.93 | 0.00e+00 | 95.6% |
| 61 | JQ651374 | Pseudococcus viburni voucher ARCPPRI SB292_3 28S ribosomal RNA gene, partial sequence | 648 | 84.5% | 1057.04 | 0.00e+00 | 95.6% |
| 62 | JQ651372 | Pseudococcus viburni voucher ARCPPRI SB292_1 28S ribosomal RNA gene, partial sequence | 568 | 74.1% | 932.156 | 0.00e+00 | 95.6% |
| 63 | EU188488 | Sphaerococcus casuarinae 28S large subunit ribosomal RNA gene, partial sequence | 293 | 38.2% | 476.235 | 2.75e-129 | 95.6% |
| 64 | KY565046 | Pseudococcus nakaharai haplotype 21 28S ribosomal RNA gene, partial sequence | 762 | 99.3% | 1241.39 | 0.00e+00 | 95.5% |
| 65 | MW542034 | Paraputo kaiensis voucher PCG1 large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 1223.55 | 0.00e+00 | 95.5% |
| 66 | KU499441 | Pseudococcus comstocki isolate M28S-01 28S ribosomal RNA gene, partial sequence | 760 | 99.1% | 1235.44 | 0.00e+00 | 95.4% |
| 67 | KP692431 | Pseudococcus odermatti isolate S3-188 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1189.85 | 0.00e+00 | 95.4% |
| 68 | MK873098 | Pseudococcus odermatti voucher LL9 large subunit ribosomal RNA gene, partial sequence | 708 | 92.3% | 1146.24 | 0.00e+00 | 95.4% |
| 69 | JQ651376 | Pseudococcus viburni voucher ARCPPRI SB292_5 28S ribosomal RNA gene, partial sequence | 651 | 84.9% | 1055.06 | 0.00e+00 | 95.4% |
| 70 | JX500006 | Pseudococcus viburni voucher ARC-PPRI SB265.2 28S ribosomal RNA gene, partial sequence | 513 | 66.9% | 829.078 | 0.00e+00 | 95.4% |
| 71 | KP692414 | Pseudococcus comstocki isolate S3-584 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1183.9 | 0.00e+00 | 95.3% |
| 72 | MK873092 | Pseudococcus comstocki voucher LL3 large subunit ribosomal RNA gene, partial sequence | 725 | 94.5% | 1172.01 | 0.00e+00 | 95.3% |
| 73 | JX500001 | Paracoccus burnerae voucher ARC-PPRI SB22.2 28S ribosomal RNA gene, partial sequence | 448 | 58.4% | 720.054 | 0.00e+00 | 95.3% |
| 74 | JX499998 | Planococcus citri voucher ARC-PPRI SB18.1 28S ribosomal RNA gene, partial sequence | 492 | 64.1% | 789.9245000000001 | 1.02e-223 | 95.3% |
| 75 | MW542047 | Pseudococcus cryptus voucher 140913-JY-13A(IN85R1) large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 1201.74 | 0.00e+00 | 95.2% |
| 76 | KY211360 | Pseudococcus comstocki isolate S5-405 28S ribosomal RNA gene, partial sequence | 723 | 94.3% | 1162.1 | 0.00e+00 | 95.2% |
| 77 | KY565028 | Dysmicoccus sylvarum haplotype 3 28S ribosomal RNA gene, partial sequence | 715 | 93.2% | 1146.24 | 0.00e+00 | 95.2% |
| 78 | KY565032 | Dysmicoccus texensis haplotype 7 28S ribosomal RNA gene, partial sequence | 637 | 83.1% | 1019.38 | 0.00e+00 | 95.2% |
| 79 | ON787845 | Dysmicoccus brevipes voucher MN 06 large subunit ribosomal RNA gene, partial sequence | 432 | 56.3% | 690.32 | 0.00e+00 | 95.2% |
| 80 | PQ149469 | Phenacoccus saccharifolii isolate CMB2 large subunit ribosomal RNA gene, partial sequence | 392 | 51.1% | 625.3969999999999 | 3.44e-174 | 95.2% |
| 81 | PQ154573 | Phenacoccus saccharifolii isolate CMB6 large subunit ribosomal RNA gene, partial sequence | 392 | 51.1% | 625.3969999999999 | 3.44e-174 | 95.2% |
| 82 | MW542016 | Phenacoccus rubicola voucher 170430-JY-01(IN30) large subunit ribosomal RNA gene, partial sequence | 376 | 49.0% | 602.1013 | 3.55e-167 | 95.2% |
| 83 | MW542066 | Trionymus perrisii voucher 190525-JY-03(PDB1) large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 1199.76 | 0.00e+00 | 95.1% |
| 84 | MZ147004 | Pseudococcus viburni voucher PV28SCOL large subunit ribosomal RNA gene, partial sequence | 582 | 75.9% | 926.209 | 0.00e+00 | 95.1% |
| 85 | GU998967 | Planococcus citri isolate D1142A 28S ribosomal RNA gene, partial sequence | 488 | 63.6% | 780.013 | 9.84e-221 | 95.1% |
| 86 | KU891795 | Dysmicoccus neobrevipes isolate 13 28S large subunit ribosomal RNA gene, partial sequence | 732 | 95.4% | 1158.13 | 0.00e+00 | 95.0% |
| 87 | KU891796 | Dysmicoccus neobrevipes isolate 25 28S large subunit ribosomal RNA gene, partial sequence | 732 | 95.4% | 1150.2 | 0.00e+00 | 94.9% |
| 88 | AY427333 | Erium globosum 28S large subunit ribosomal RNA gene, partial sequence | 314 | 40.9% | 494.076 | 1.17e-134 | 94.9% |
| 89 | MW542035 | Dysmicoccus wistariae voucher 170621-JY-01(IN80) large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 1181.92 | 0.00e+00 | 94.8% |
| 90 | KP692280 | Dysmicoccus brevipes isolate S3-691 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 1150.2 | 0.00e+00 | 94.7% |
| 91 | KU891798 | Dysmicoccus brevipes isolate 18 28S large subunit ribosomal RNA gene, partial sequence | 732 | 95.4% | 1146.24 | 0.00e+00 | 94.7% |
| 92 | KU891797 | Dysmicoccus neobrevipes isolate 62 28S large subunit ribosomal RNA gene, partial sequence | 732 | 95.4% | 1142.28 | 0.00e+00 | 94.7% |
| 93 | KY565045 | Dysmicoccus sp. FP-2017 haplotype 20 28S ribosomal RNA gene, partial sequence | 715 | 93.2% | 1122.45 | 0.00e+00 | 94.7% |
| 94 | AY427365 | Trionymus idahoensis 28S large subunit ribosomal RNA gene, partial sequence | 314 | 40.9% | 490.111 | 1.83e-133 | 94.7% |
| 95 | MW542046 | Pseudococcus comstocki voucher 140913-JY-13B(IN85) large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 1170.03 | 0.00e+00 | 94.6% |
| 96 | KU891799 | Dysmicoccus brevipes isolate 19 28S large subunit ribosomal RNA gene, partial sequence | 732 | 95.4% | 1138.31 | 0.00e+00 | 94.6% |
| 97 | JQ085538 | Trionymus bambusae voucher 1100353 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 486.147 | 2.86e-132 | 94.6% |
| 98 | MW542050 | Pseudococcus viburni voucher 171004-JY-04(IN86) large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 1156.15 | 0.00e+00 | 94.5% |
| 99 | KY565029 | Dysmicoccus brevipes haplotype 4 28S ribosomal RNA gene, partial sequence | 718 | 93.6% | 1100.65 | 0.00e+00 | 94.3% |
| 100 | KJ530586 | Pseudococcus cryptus voucher 1200874 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 480.2 | 1.76e-130 | 94.3% |
| 101 | KP771928 | Delottococcus phylicus voucher 12401 28S ribosomal RNA gene, partial sequence | 758 | 98.8% | 1152.19 | 0.00e+00 | 94.1% |
| 102 | JQ651250 | Dysmicoccus brevipes voucher ARCPPRI SB209_1 28S ribosomal RNA gene, partial sequence | 650 | 84.7% | 983.695 | 0.00e+00 | 94.1% |
| 103 | KP771930 | Delottococcus aberiae voucher 12426 28S ribosomal RNA gene, partial sequence | 758 | 98.8% | 1146.24 | 0.00e+00 | 94.0% |
| 104 | KP771927 | Delottococcus confusus voucher 12395 28S ribosomal RNA gene, partial sequence | 758 | 98.8% | 1142.28 | 0.00e+00 | 94.0% |
| 105 | KP771931 | Delottococcus confusus voucher 12431 28S ribosomal RNA gene, partial sequence | 758 | 98.8% | 1142.28 | 0.00e+00 | 94.0% |
| 106 | KY211361 | Pseudococcus saccharicola isolate S5-442F 28S ribosomal RNA gene, partial sequence | 723 | 94.3% | 1078.84 | 0.00e+00 | 94.0% |
| 107 | JQ651251 | Dysmicoccus brevipes voucher ARCPPRI SB209_2 28S ribosomal RNA gene, partial sequence | 649 | 84.6% | 981.712 | 0.00e+00 | 94.0% |
| 108 | JQ651252 | Dysmicoccus brevipes voucher ARCPPRI SB209_3 28S ribosomal RNA gene, partial sequence | 646 | 84.2% | 975.765 | 0.00e+00 | 94.0% |
| 109 | JQ651254 | Dysmicoccus brevipes voucher ARCPPRI SB209_5 28S ribosomal RNA gene, partial sequence | 645 | 84.1% | 973.783 | 0.00e+00 | 94.0% |
| 110 | KY211342 | Phenacoccus nr. aceris S3-173 28S ribosomal RNA gene, partial sequence | 351 | 45.8% | 528.2660000000001 | 5.98e-145 | 94.0% |
| 111 | KY211339 | Phenacoccus nr. aceris S3-157a 28S ribosomal RNA gene, partial sequence | 351 | 45.8% | 528.2660000000001 | 5.98e-145 | 94.0% |
| 112 | KY211341 | Phenacoccus nr. aceris S3-169 28S ribosomal RNA gene, partial sequence | 351 | 45.8% | 528.2660000000001 | 5.98e-145 | 94.0% |
| 113 | KY211343 | Phenacoccus nr. aceris S3-178 28S ribosomal RNA gene, partial sequence | 351 | 45.8% | 528.2660000000001 | 5.98e-145 | 94.0% |
| 114 | KP771926 | Delottococcus aberiae voucher 12385 28S ribosomal RNA gene, partial sequence | 758 | 98.8% | 1142.28 | 0.00e+00 | 93.9% |
| 115 | KP771933 | Delottococcus aberiae voucher 8607 28S ribosomal RNA gene, partial sequence | 736 | 96.0% | 1102.63 | 0.00e+00 | 93.9% |
| 116 | MW542055 | Rastrococcus spinosus voucher 190224-MY-13(IN52) large subunit ribosomal RNA gene, partial sequence | 425 | 55.4% | 639.7648 | 1.63e-178 | 93.9% |
| 117 | KY939986 | Phenacoccus aceris isolate S3-178B 28S ribosomal RNA gene, partial sequence | 344 | 44.9% | 514.39 | 8.99e-141 | 93.9% |
| 118 | KY939941 | Phenacoccus aceris isolate S3-143-4 28S ribosomal RNA gene, partial sequence | 344 | 44.9% | 514.39 | 8.99e-141 | 93.9% |
| 119 | KY940003 | Phenacoccus aceris isolate S3-473 28S ribosomal RNA gene, partial sequence | 344 | 44.9% | 514.39 | 8.99e-141 | 93.9% |
| 120 | KY939939 | Phenacoccus aceris isolate S3-143 28S ribosomal RNA gene, partial sequence | 344 | 44.9% | 514.39 | 8.99e-141 | 93.9% |
| 121 | KY940005 | Phenacoccus aceris isolate S3-478 28S ribosomal RNA gene, partial sequence | 344 | 44.9% | 514.39 | 8.99e-141 | 93.9% |
| 122 | KY940007 | Phenacoccus aceris isolate S3-485 28S ribosomal RNA gene, partial sequence | 344 | 44.9% | 514.39 | 8.99e-141 | 93.9% |
| 123 | KP692355 | Phenacoccus nr. aceris 2 XBW-2015 isolate S3-144 28S ribosomal RNA gene, partial sequence | 344 | 44.9% | 514.39 | 8.99e-141 | 93.9% |
| 124 | KY940004 | Phenacoccus aceris isolate S3-475 28S ribosomal RNA gene, partial sequence | 344 | 44.9% | 514.39 | 8.99e-141 | 93.9% |
| 125 | KY939958 | Phenacoccus aceris isolate S3-157B 28S ribosomal RNA gene, partial sequence | 344 | 44.9% | 514.39 | 8.99e-141 | 93.9% |
| 126 | KP692358 | Phenacoccus nr. aceris 2 XBW-2015 isolate S3-402 28S ribosomal RNA gene, partial sequence | 344 | 44.9% | 514.39 | 8.99e-141 | 93.9% |
| 127 | KY939985 | Phenacoccus aceris isolate S3-178A 28S ribosomal RNA gene, partial sequence | 344 | 44.9% | 514.39 | 8.99e-141 | 93.9% |
| 128 | KP692356 | Phenacoccus nr. aceris 2 XBW-2015 isolate S3-150 28S ribosomal RNA gene, partial sequence | 344 | 44.9% | 514.39 | 8.99e-141 | 93.9% |
| 129 | MW542042 | Phenacoccus sp. 3 JC-2021 voucher 170121-MY-04(IN44) large subunit ribosomal RNA gene, partial sequence | 368 | 48.0% | 546.106 | 2.55e-150 | 93.8% |
| 130 | KY211340 | Phenacoccus nr. aceris S3-163 28S ribosomal RNA gene, partial sequence | 351 | 45.8% | 520.337 | 1.46e-142 | 93.7% |
| 131 | MW542022 | Dysmicoccus neobrevipes voucher 141026-LAO-81(IN72) large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 1108.58 | 0.00e+00 | 93.6% |
| 132 | JX500004 | Delottococcus aberiae voucher ARC-PPRI SB259.5 28S ribosomal RNA gene, partial sequence | 705 | 91.9% | 1041.18 | 0.00e+00 | 93.6% |
| 133 | JQ651295 | Vryburgia transvaalensis voucher ARCPPRI SB241_2 28S ribosomal RNA gene, partial sequence | 581 | 75.7% | 856.83 | 0.00e+00 | 93.6% |
| 134 | JQ651297 | Vryburgia transvaalensis voucher ARCPPRI SB241_7 28S ribosomal RNA gene, partial sequence | 579 | 75.5% | 852.865 | 0.00e+00 | 93.6% |
| 135 | KP771934 | Vryburgia transvaalensis voucher 12391 28S ribosomal RNA gene, partial sequence | 758 | 98.8% | 1116.51 | 0.00e+00 | 93.5% |
| 136 | MW542021 | Dysmicoccus brevipes voucher 161012-MY-02(IN70) large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 1098.67 | 0.00e+00 | 93.5% |
| 137 | AY427354 | Pseudococcus odermatti 28S large subunit ribosomal RNA gene, partial sequence | 314 | 40.9% | 458.395 | 6.45e-124 | 93.4% |
| 138 | AY427345 | Trionymus frontalis 28S large subunit ribosomal RNA gene, partial sequence | 314 | 40.9% | 458.395 | 6.45e-124 | 93.4% |
| 139 | JQ651344 | Delottococcus aberiae voucher ARCPPRI SB256_2 28S ribosomal RNA gene, partial sequence | 669 | 87.2% | 969.819 | 0.00e+00 | 93.3% |
| 140 | KP692321 | Heterococcus nudus isolate 2547 28S ribosomal RNA gene, partial sequence | 419 | 54.6% | 606.0661 | 2.27e-168 | 93.3% |
| 141 | JQ651358 | Delottococcus aberiae voucher ARCPPRI SB259_1 28S ribosomal RNA gene, partial sequence | 649 | 84.6% | 930.173 | 0.00e+00 | 93.1% |
| 142 | GU134653 | Pseudococcus viburni haplotype H2 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 450.466 | 1.57e-121 | 93.1% |
| 143 | GU134652 | Pseudococcus viburni haplotype H1 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 450.466 | 1.57e-121 | 93.1% |
| 144 | MG866180 | Pseudococcus viburni clone 3-28S 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 450.466 | 1.57e-121 | 93.1% |
| 145 | JQ651346 | Delottococcus aberiae voucher ARCPPRI SB256_4 28S ribosomal RNA gene, partial sequence | 645 | 84.1% | 922.244 | 0.00e+00 | 93.0% |
| 146 | JQ651343 | Delottococcus aberiae voucher ARCPPRI SB256_1 28S ribosomal RNA gene, partial sequence | 645 | 84.1% | 922.244 | 0.00e+00 | 93.0% |
| 147 | JQ651347 | Delottococcus aberiae voucher ARCPPRI SB256_7 28S ribosomal RNA gene, partial sequence | 645 | 84.1% | 922.244 | 0.00e+00 | 93.0% |
| 148 | JQ651359 | Delottococcus aberiae voucher ARCPPRI SB259_2 28S ribosomal RNA gene, partial sequence | 643 | 83.8% | 918.28 | 0.00e+00 | 93.0% |
| 149 | JQ651345 | Delottococcus aberiae voucher ARCPPRI SB256_3 28S ribosomal RNA gene, partial sequence | 643 | 83.8% | 918.28 | 0.00e+00 | 93.0% |
| 150 | JQ651360 | Delottococcus aberiae voucher ARCPPRI SB259_3 28S ribosomal RNA gene, partial sequence | 643 | 83.8% | 918.28 | 0.00e+00 | 93.0% |
| 151 | AY427312 | Pseudococcus maritimus 28S large subunit ribosomal RNA gene, partial sequence | 314 | 40.9% | 448.484 | 6.22e-121 | 93.0% |
| 152 | GU134655 | Pseudococcus nr. maritimus TM-2009 haplotype H1 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 446.501 | 2.46e-120 | 93.0% |
| 153 | JQ651294 | Vryburgia transvaalensis voucher ARCPPRI SB241_1 28S ribosomal RNA gene, partial sequence | 633 | 82.5% | 898.457 | 0.00e+00 | 92.9% |
| 154 | JQ651298 | Vryburgia transvaalensis voucher ARCPPRI SB241_8 28S ribosomal RNA gene, partial sequence | 631 | 82.3% | 894.493 | 0.00e+00 | 92.9% |
| 155 | JQ651296 | Vryburgia transvaalensis voucher ARCPPRI SB241_6 28S ribosomal RNA gene, partial sequence | 629 | 82.0% | 890.528 | 0.00e+00 | 92.9% |
| 156 | JQ651361 | Delottococcus aberiae voucher ARCPPRI SB259_4 28S ribosomal RNA gene, partial sequence | 640 | 83.4% | 904.404 | 0.00e+00 | 92.8% |
| 157 | KJ530584 | Pseudococcus nr. viburni 0902313 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 442.537 | 3.83e-119 | 92.8% |
| 158 | KP692273 | Dysmicoccus boninsis isolate S3-599 28S ribosomal RNA gene, partial sequence | 726 | 94.7% | 1033.743 | 4.10e-297 | 92.7% |
| 159 | OQ221565 | Ferrisia virgata isolate FS1 large subunit ribosomal RNA gene, partial sequence | 558 | 72.8% | 783.486 | 0.00e+00 | 92.7% |
| 160 | KJ530587 | Pseudococcus nr. sociabilis 1101839 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 438.572 | 5.98e-118 | 92.7% |
| 161 | MK873097 | Dysmicoccus boninsis voucher LL8 large subunit ribosomal RNA gene, partial sequence | 712 | 92.8% | 1005.992 | 9.26e-289 | 92.6% |
| 162 | KP692277 | Dysmicoccus boninsis isolate S3-878 28S ribosomal RNA gene, partial sequence | 726 | 94.7% | 1025.814 | 9.99e-295 | 92.6% |
| 163 | OR046674 | Ferrisia virgata isolate FS3-28S large subunit ribosomal RNA gene, partial sequence | 698 | 91.0% | 960.3995 | 4.91e-275 | 92.5% |
| 164 | KY565035 | Phenacoccus tucumanus haplotype 10 28S ribosomal RNA gene, partial sequence | 437 | 57.0% | 601.61 | 4.99e-167 | 92.5% |
| 165 | KY565040 | Ferrisia terani haplotype 15 28S ribosomal RNA gene, partial sequence | 762 | 99.3% | 1045.14 | 0.00e+00 | 92.4% |
| 166 | KY565039 | Ferrisia meridionalis haplotype 14 28S ribosomal RNA gene, partial sequence | 762 | 99.3% | 1043.16 | 0.00e+00 | 92.4% |
| 167 | KJ530594 | Pseudococcus sp. 1101830 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 430.643 | 1.46e-115 | 92.4% |
| 168 | JQ651317 | Sphaerococcus durus voucher ARCPPRI SB247_6 28S ribosomal RNA gene, partial sequence | 664 | 86.6% | 902.422 | 0.00e+00 | 92.2% |
| 169 | PQ851060 | Maconellicoccus hirsutus isolate NBAIR large subunit ribosomal RNA gene, partial sequence | 446 | 58.1% | 593.189 | 1.71e-164 | 92.2% |
| 170 | PQ149446 | Phenacoccus saccharifolii isolate CMB1 large subunit ribosomal RNA gene, partial sequence | 524 | 68.3% | 709.1441 | 2.12e-199 | 92.1% |
| 171 | JQ651321 | Sphaerococcus durus voucher ARCPPRI SB247_10 28S ribosomal RNA gene, partial sequence | 650 | 84.7% | 874.67 | 0.00e+00 | 92.0% |
| 172 | JQ651318 | Sphaerococcus durus voucher ARCPPRI SB247_7 28S ribosomal RNA gene, partial sequence | 650 | 84.7% | 874.67 | 0.00e+00 | 92.0% |
| 173 | JQ651316 | Sphaerococcus durus voucher ARCPPRI SB247_5 28S ribosomal RNA gene, partial sequence | 648 | 84.5% | 870.706 | 0.00e+00 | 92.0% |
| 174 | JQ651320 | Sphaerococcus durus voucher ARCPPRI SB247_9 28S ribosomal RNA gene, partial sequence | 647 | 84.4% | 868.723 | 0.00e+00 | 92.0% |
| 175 | JQ651315 | Sphaerococcus durus voucher ARCPPRI SB247_4 28S ribosomal RNA gene, partial sequence | 646 | 84.2% | 866.741 | 0.00e+00 | 92.0% |
| 176 | JQ651312 | Sphaerococcus durus voucher ARCPPRI SB247_1 28S ribosomal RNA gene, partial sequence | 646 | 84.2% | 866.741 | 0.00e+00 | 92.0% |
| 177 | JQ651319 | Sphaerococcus durus voucher ARCPPRI SB247_8 28S ribosomal RNA gene, partial sequence | 646 | 84.2% | 866.741 | 0.00e+00 | 92.0% |
| 178 | KP692293 | Formicococcus sp. S4-208 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 981.712 | 0.00e+00 | 91.9% |
| 179 | KP692467 | Trionymus townesi isolate S3-885 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 969.819 | 0.00e+00 | 91.9% |
| 180 | KY211337 | Pseudococcus baliteus isolate M4-002 28S ribosomal RNA gene, partial sequence | 723 | 94.3% | 951.978 | 0.00e+00 | 91.9% |
| 181 | JQ651313 | Sphaerococcus durus voucher ARCPPRI SB247_2 28S ribosomal RNA gene, partial sequence | 642 | 83.7% | 858.812 | 0.00e+00 | 91.9% |
| 182 | JQ651314 | Sphaerococcus durus voucher ARCPPRI SB247_3 28S ribosomal RNA gene, partial sequence | 641 | 83.6% | 856.83 | 0.00e+00 | 91.9% |
| 183 | KY085475 | Hemiberlesia rapax isolate 19432 28S ribosomal RNA gene, partial sequence | 466 | 60.8% | 619.9421 | 1.51e-172 | 91.9% |
| 184 | KY085545 | Hemiberlesia lataniae isolate 19467 28S ribosomal RNA gene, partial sequence | 466 | 60.8% | 619.9421 | 1.51e-172 | 91.9% |
| 185 | FJ040869 | Hemiberlesia lataniae 28S ribosomal RNA gene, partial sequence | 467 | 60.9% | 621.9244 | 3.82e-173 | 91.9% |
| 186 | FJ040870 | Hemiberlesia nr. lataniae AS313 28S ribosomal RNA gene, partial sequence | 467 | 60.9% | 621.9244 | 3.82e-173 | 91.9% |
| 187 | KY085572 | Hemiberlesia lataniae isolate 19453 28S ribosomal RNA gene, partial sequence | 466 | 60.8% | 619.9421 | 1.51e-172 | 91.9% |
| 188 | KP692405 | Planococcus lilacinus isolate S3-695a 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 971.801 | 0.00e+00 | 91.8% |
| 189 | KP771929 | Paracoccus burnerae voucher 12414 28S ribosomal RNA gene, partial sequence | 758 | 98.8% | 999.553 | 0.00e+00 | 91.7% |
| 190 | MW542020 | Dysmicoccus boninsis voucher 180606-JY-02(IN69) large subunit ribosomal RNA gene, partial sequence | 756 | 98.6% | 995.588 | 0.00e+00 | 91.7% |
| 191 | KY565038 | Planococcus citri haplotype 13 28S ribosomal RNA gene, partial sequence | 762 | 99.3% | 995.588 | 0.00e+00 | 91.7% |
| 192 | ON950746 | Planococcus lilacinus voucher ZA large subunit ribosomal RNA gene, partial sequence | 719 | 93.7% | 942.067 | 0.00e+00 | 91.7% |
| 193 | MK873099 | Planococcus lilacinus voucher LL10 large subunit ribosomal RNA gene, partial sequence | 719 | 93.7% | 942.067 | 0.00e+00 | 91.7% |
| 194 | KX015052 | Pseudococcus jackbeardsleyi voucher 4504001ZJ1500296 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 412.803 | 3.42e-110 | 91.7% |
| 195 | KP692376 | Phenacoccus saccharifolii isolate M4-005a 28S ribosomal RNA gene, partial sequence | 499 | 65.1% | 659.5871999999999 | 1.76e-184 | 91.7% |
| 196 | KY085472 | Hemiberlesia rapax isolate 19442 28S ribosomal RNA gene, partial sequence | 466 | 60.8% | 610.0308 | 1.46e-169 | 91.7% |
| 197 | KY085466 | Hemiberlesia rapax isolate 19492 28S ribosomal RNA gene, partial sequence | 466 | 60.8% | 612.0131 | 3.68e-170 | 91.7% |
| 198 | KY085471 | Hemiberlesia rapax isolate 19547 28S ribosomal RNA gene, partial sequence | 466 | 60.8% | 612.0131 | 3.68e-170 | 91.7% |
| 199 | KY085552 | Hemiberlesia lataniae isolate 19416 28S ribosomal RNA gene, partial sequence | 466 | 60.8% | 610.0308 | 1.46e-169 | 91.7% |
| 200 | KY085529 | Diaspidiotus ancylus isolate 19538 28S ribosomal RNA gene, partial sequence | 466 | 60.8% | 612.0131 | 3.68e-170 | 91.7% |
| 201 | MT677284 | Lopholeucaspis cockerelli voucher UMEC:D4196B 28S ribosomal RNA gene, partial sequence | 467 | 60.9% | 613.9954 | 9.32e-171 | 91.7% |
| 202 | MT677192 | Lopholeucaspis cockerelli voucher UMEC:D3995A 28S ribosomal RNA gene, partial sequence | 467 | 60.9% | 613.9954 | 9.32e-171 | 91.7% |
| 203 | KY565037 | Planococcus ficus haplotype 12 28S ribosomal RNA gene, partial sequence | 762 | 99.3% | 987.659 | 0.00e+00 | 91.6% |
| 204 | KY211352 | Planococcus lilacinus isolate S5-088 28S ribosomal RNA gene, partial sequence | 723 | 94.3% | 942.067 | 0.00e+00 | 91.6% |
| 205 | DQ145340 | Hemiberlesia lataniae isolate D038A 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 544.124 | 1.01e-149 | 91.6% |
| 206 | GQ325487 | Hemiberlesia lataniae isolate D0038B 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 544.124 | 1.01e-149 | 91.6% |
| 207 | MK636561 | Hemiberlesia lataniae isolate P2_H_lataniae-Hap2 large subunit ribosomal RNA gene, partial sequence. | 416 | 54.2% | 544.124 | 1.01e-149 | 91.6% |
| 208 | JQ651163 | Ferrisia malvastra voucher ARCPPRI SB11_6 28S ribosomal RNA gene, partial sequence | 738 | 96.2% | 961.89 | 0.00e+00 | 91.5% |
| 209 | GU134658 | Dysmicoccus brevipes haplotype H1 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 412.803 | 3.42e-110 | 91.5% |
| 210 | OP390082 | Phenacoccus sp. 1 SBH-2022a isolate xiaopeng large subunit ribosomal RNA gene, partial sequence | 529 | 69.0% | 685.357 | 3.07e-192 | 91.5% |
| 211 | FJ040866 | Acutaspis albopicta 28S ribosomal RNA gene, partial sequence | 467 | 60.9% | 606.0663 | 2.27e-168 | 91.5% |
| 212 | FJ040865 | Abgrallaspis perseae 28S ribosomal RNA gene, partial sequence | 467 | 60.9% | 606.0663999999999 | 2.27e-168 | 91.5% |
| 213 | KP692388 | Planococcus citri isolate S3-120 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 940.085 | 0.00e+00 | 91.4% |
| 214 | KU891801 | Planococcus citri isolate 79 28S large subunit ribosomal RNA gene, partial sequence | 732 | 95.4% | 936.12 | 0.00e+00 | 91.4% |
| 215 | JQ651165 | Planococcus citri voucher ARCPPRI SB18_4 28S ribosomal RNA gene, partial sequence | 731 | 95.3% | 934.138 | 0.00e+00 | 91.4% |
| 216 | MH248326 | Phenacoccus solenopsis voucher PS39 large subunit ribosomal RNA gene, partial sequence | 478 | 62.3% | 611.029 | 7.28e-170 | 91.4% |
| 217 | KX015038 | Pseudococcus jackbeardsleyi voucher 4504001ZJ1500471 28S ribosomal RNA gene, partial sequence | 314 | 40.9% | 404.874 | 8.34e-108 | 91.4% |
| 218 | AY427320 | Dysmicoccus brevipes 28S large subunit ribosomal RNA gene, partial sequence | 298 | 38.9% | 389.016 | 4.96e-103 | 91.4% |
| 219 | DQ145343 | Hemiberlesia rapax isolate D271A 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 536.1949999999999 | 2.45e-147 | 91.4% |
| 220 | GQ325576 | Diaspididae sp. D2029A 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 536.1949999999999 | 2.45e-147 | 91.4% |
| 221 | DQ145339 | Hemiberlesia lataniae isolate D007B 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 536.1949999999999 | 2.45e-147 | 91.4% |
| 222 | GQ325488 | Hemiberlesia lataniae isolate D0766B 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 536.1949999999999 | 2.45e-147 | 91.4% |
| 223 | KY085469 | Hemiberlesia rapax isolate 19521 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 536.1949999999999 | 2.45e-147 | 91.4% |
| 224 | MK636560 | Hemiberlesia lataniae isolate P2_H_lataniae_Hap1 large subunit ribosomal RNA gene, partial sequence. | 416 | 54.2% | 536.1949999999999 | 2.45e-147 | 91.4% |
| 225 | KX091266 | Diaspidiotus nr. gigas 2 YZZ-2017 isolate S3-915B 28S ribosomal RNA gene, partial sequence | 463 | 60.4% | 598.1374000000001 | 5.54e-166 | 91.4% |
| 226 | KX091248 | Chrysomphalus bifasciculatus isolate D5-275A 28S ribosomal RNA gene, partial sequence | 463 | 60.4% | 598.1374000000001 | 5.54e-166 | 91.4% |
| 227 | KX091251 | Chrysomphalus aonidum isolate SE5-016B 28S ribosomal RNA gene, partial sequence | 463 | 60.4% | 598.1374000000001 | 5.54e-166 | 91.4% |
| 228 | KX091246 | Aonidiella nr. aurantii 2 YZZ-2017 isolate D5-290A 28S ribosomal RNA gene, partial sequence | 463 | 60.4% | 598.1374000000001 | 5.54e-166 | 91.4% |
| 229 | KX091250 | Chrysomphalus aonidum isolate SE5-016A 28S ribosomal RNA gene, partial sequence | 463 | 60.4% | 598.1374000000001 | 5.54e-166 | 91.4% |
| 230 | KX091249 | Chrysomphalus bifasciculatus isolate D5-275B 28S ribosomal RNA gene, partial sequence | 463 | 60.4% | 598.1374000000001 | 5.54e-166 | 91.4% |
| 231 | KX091265 | Diaspidiotus nr. gigas 2 YZZ-2017 isolate S3-915A 28S ribosomal RNA gene, partial sequence | 463 | 60.4% | 598.1374000000001 | 5.54e-166 | 91.4% |
| 232 | KX091247 | Aonidiella nr. aurantii 2 YZZ-2017 isolate D5-290B 28S ribosomal RNA gene, partial sequence | 463 | 60.4% | 598.1374000000001 | 5.54e-166 | 91.4% |
| 233 | KP692400 | Planococcus kraunhiae isolate S4-153 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 940.085 | 0.00e+00 | 91.3% |
| 234 | KY211353 | Planococcus citri isolate S5-092 28S ribosomal RNA gene, partial sequence | 723 | 94.3% | 918.28 | 0.00e+00 | 91.3% |
| 235 | JQ651362 | Planococcus citri voucher ARCPPRI SB263_1 28S ribosomal RNA gene, partial sequence | 723 | 94.3% | 918.28 | 0.00e+00 | 91.3% |
| 236 | KM350541 | Planococcus sp. FL-2014 isolate UASWS1253 28S ribosomal RNA gene, partial sequence | 718 | 93.6% | 916.298 | 0.00e+00 | 91.3% |
| 237 | MH248356 | Phenacoccus giganteus voucher S0073A large subunit ribosomal RNA gene, partial sequence | 460 | 60.0% | 583.277 | 1.65e-161 | 91.3% |
| 238 | KY085486 | Chrysomphalus dictyospermi isolate 24320 28S ribosomal RNA gene, partial sequence | 466 | 60.8% | 596.1551000000001 | 2.19e-165 | 91.3% |
| 239 | MT677479 | Pseudotargionia sp. ud4596 voucher UMEC:D5028A 28S ribosomal RNA gene, partial sequence | 467 | 60.9% | 598.1374 | 5.54e-166 | 91.3% |
| 240 | MT677378 | Diaspididae sp. UMEC D4619C voucher UMEC:D4619C 28S ribosomal RNA gene, partial sequence | 467 | 60.9% | 598.1374 | 5.54e-166 | 91.3% |
| 241 | MW542044 | Planococcus kraunhiae voucher 180516-JY-09A(IN83) large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 955.943 | 0.00e+00 | 91.2% |
| 242 | MW542018 | Crisicoccus pini voucher 170618-JY-01(IN68) large subunit ribosomal RNA gene, partial sequence | 749 | 97.7% | 948.014 | 0.00e+00 | 91.2% |
| 243 | KP692401 | Planococcus kraunhiae isolate S4-227 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 932.156 | 0.00e+00 | 91.2% |
| 244 | KP692402 | Planococcus kraunhiae isolate S4-247 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 932.156 | 0.00e+00 | 91.2% |
| 245 | AY427309 | Pseudococcus viburni 28S large subunit ribosomal RNA gene, partial sequence | 314 | 40.9% | 422.714 | 3.55e-113 | 91.2% |
| 246 | AY427350 | Paradoxococcus mcdanieli 28S large subunit ribosomal RNA gene, partial sequence | 314 | 40.9% | 402.891 | 3.30e-107 | 91.2% |
| 247 | DQ145368 | Aspidiella sacchari isolate D571C 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 528.266 | 5.98e-145 | 91.2% |
| 248 | KX091259 | Aonidiella nr. citrina 2 YZZ-2017 isolate D5-344B 28S ribosomal RNA gene, partial sequence | 463 | 60.4% | 590.2084 | 1.35e-163 | 91.2% |
| 249 | KX091256 | Aonidiella nr. citrina 2 YZZ-2017 isolate D5-330A 28S ribosomal RNA gene, partial sequence | 463 | 60.4% | 590.2084 | 1.35e-163 | 91.2% |
| 250 | KX091254 | Aonidiella nr. citrina 2 YZZ-2017 isolate S4-67 28S ribosomal RNA gene, partial sequence | 463 | 60.4% | 590.2084 | 1.35e-163 | 91.2% |
| 251 | KP692408 | Planococcus minor isolate S3-645 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 924.227 | 0.00e+00 | 91.1% |
| 252 | KU891800 | Planococcus minor isolate 78 28S large subunit ribosomal RNA gene, partial sequence | 732 | 95.4% | 920.262 | 0.00e+00 | 91.1% |
| 253 | JQ651166 | Paracoccus burnerae voucher ARCPPRI SB22_5 28S ribosomal RNA gene, partial sequence | 695 | 90.6% | 880.617 | 0.00e+00 | 91.1% |
| 254 | JQ651170 | Planococcus citri voucher ARCPPRI SB32_3 28S ribosomal RNA gene, partial sequence | 698 | 91.0% | 876.652 | 0.00e+00 | 91.1% |
| 255 | OR991745 | Phenacoccus solenopsis isolate W1 large subunit ribosomal RNA gene, partial sequence | 483 | 63.0% | 603.1 | 1.78e-167 | 91.1% |
| 256 | MK873095 | Phenacoccus solenopsis voucher LL6 large subunit ribosomal RNA gene, partial sequence | 460 | 60.0% | 575.348 | 4.01e-159 | 91.1% |
| 257 | MH248360 | Phenacoccus solenopsis voucher S0080A large subunit ribosomal RNA gene, partial sequence | 460 | 60.0% | 575.348 | 4.01e-159 | 91.1% |
| 258 | MH248354 | Phenacoccus solenopsis voucher S0070A large subunit ribosomal RNA gene, partial sequence | 460 | 60.0% | 575.348 | 4.01e-159 | 91.1% |
| 259 | MH248307 | Phenacoccus solenopsis voucher PS17 large subunit ribosomal RNA gene, partial sequence | 459 | 59.8% | 573.366 | 1.59e-158 | 91.1% |
| 260 | MH248331 | Phenacoccus solenopsis voucher PS45 large subunit ribosomal RNA gene, partial sequence | 459 | 59.8% | 573.366 | 1.59e-158 | 91.1% |
| 261 | ON554842 | Aspidiotus cryptomeriae isolate XFP2 large subunit ribosomal RNA gene, partial sequence | 412 | 53.7% | 520.337 | 1.46e-142 | 91.1% |
| 262 | KY211346 | Planococcus minor isolate S4-031 28S ribosomal RNA gene, partial sequence | 723 | 94.3% | 902.422 | 0.00e+00 | 91.0% |
| 263 | MW542056 | Rastrococcus tropicasiaticus voucher 180525-MY-05(IN100) large subunit ribosomal RNA gene, partial sequence | 542 | 70.7% | 676.9363 | 1.05e-189 | 91.0% |
| 264 | MH248306 | Phenacoccus solenopsis voucher PS16 large subunit ribosomal RNA gene, partial sequence | 453 | 59.1% | 561.473 | 6.03e-155 | 91.0% |
| 265 | ON787840 | Phenacoccus solenopsis voucher 14 large subunit ribosomal RNA gene, partial sequence | 441 | 57.5% | 545.614 | 3.58e-150 | 91.0% |
| 266 | MK636545 | Aonidiella citrina isolate P2_Ao_citrina_Hap2 large subunit ribosomal RNA gene, partial sequence. | 417 | 54.4% | 522.319 | 3.69e-143 | 91.0% |
| 267 | MK636546 | Aonidiella citrina isolate P2_Ao_citrina_Hap3 large subunit ribosomal RNA gene, partial sequence. | 417 | 54.4% | 522.319 | 3.69e-143 | 91.0% |
| 268 | DQ145288 | Aonidiella aurantii isolate D012A 28S ribosomal RNA gene, partial sequence | 408 | 53.2% | 512.408 | 3.55e-140 | 91.0% |
| 269 | MW542043 | Planococcus citri voucher 140510-JY-03(IN81) large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 932.156 | 0.00e+00 | 90.9% |
| 270 | JQ651162 | Ferrisia malvastra voucher ARCPPRI SB11_2 28S ribosomal RNA gene, partial sequence | 677 | 88.3% | 848.901 | 0.00e+00 | 90.9% |
| 271 | JQ651169 | Planococcus citri voucher ARCPPRI SB32_1 28S ribosomal RNA gene, partial sequence | 679 | 88.5% | 838.989 | 0.00e+00 | 90.9% |
| 272 | MH248359 | Phenacoccus solani voucher S0079A large subunit ribosomal RNA gene, partial sequence | 460 | 60.0% | 567.419 | 9.78e-157 | 90.9% |
| 273 | MH248313 | Phenacoccus solenopsis voucher PS23 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 274 | MH248298 | Phenacoccus solenopsis voucher PS07 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 275 | MH248316 | Phenacoccus solenopsis voucher PS26 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 276 | MH248305 | Phenacoccus solenopsis voucher PS15 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 277 | MH248311 | Phenacoccus solenopsis voucher PS21 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 278 | MH248328 | Phenacoccus solenopsis voucher PS42 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 279 | MH248315 | Phenacoccus solenopsis voucher PS25 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 280 | MH248320 | Phenacoccus solenopsis voucher PS30 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 281 | MH248322 | Phenacoccus solenopsis voucher PS34 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 282 | MH248335 | Phenacoccus solenopsis voucher PS50 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 283 | MH248330 | Phenacoccus solenopsis voucher PS44 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 284 | MH248299 | Phenacoccus solenopsis voucher PS09 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 285 | MH248297 | Phenacoccus solenopsis voucher PS05 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 286 | MH248317 | Phenacoccus solenopsis voucher PS27 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 287 | MH248327 | Phenacoccus solenopsis voucher PS40 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 288 | MH248309 | Phenacoccus solenopsis voucher PS19 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 289 | MH248318 | Phenacoccus solenopsis voucher PS28 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 290 | MH248319 | Phenacoccus solenopsis voucher PS29 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 291 | MH248294 | Phenacoccus solenopsis voucher PS02 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 292 | MH248312 | Phenacoccus solenopsis voucher PS22 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 293 | MH248334 | Phenacoccus solenopsis voucher PS49 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 294 | MH248310 | Phenacoccus solenopsis voucher PS20 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 295 | MH248308 | Phenacoccus solenopsis voucher PS18 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 296 | MH248296 | Phenacoccus solenopsis voucher PS04 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 297 | MH248329 | Phenacoccus solenopsis voucher PS43 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 298 | MH248324 | Phenacoccus solenopsis voucher PS37 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 299 | MH248325 | Phenacoccus solenopsis voucher PS38 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 300 | MH248303 | Phenacoccus solenopsis voucher PS13 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 301 | MH248293 | Phenacoccus solenopsis voucher PS01 large subunit ribosomal RNA gene, partial sequence | 452 | 58.9% | 559.49 | 2.38e-154 | 90.9% |
| 302 | ON787844 | Phenacoccus solenopsis voucher 17 large subunit ribosomal RNA gene, partial sequence | 440 | 57.4% | 543.632 | 1.42e-149 | 90.9% |
| 303 | DQ145289 | Aonidiella aurantii isolate D290A 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 304 | MK636555 | Chrysomphalus aonidum isolate P2_Ch_aonidum_Hap2 large subunit ribosomal RNA gene, partial sequence. | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 305 | MK636548 | Aonidiella citrina isolate P2_Ao_citrina_Hap5 large subunit ribosomal RNA gene, partial sequence. | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 306 | MK636558 | Chrysomphalus dictyospermi isolate P2_Ch_dictyospermi_Hap1 large subunit ribosomal RNA gene, partial sequence. | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 307 | ON464185 | Aonidiella aurantii isolate L089 large subunit ribosomal RNA gene, partial sequence | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 308 | MK630227 | Aonidiella citrina isolate P1_Ao_citrina_Hap1 large subunit ribosomal RNA gene, partial sequence | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 309 | ON508033 | Aonidiella aurantii isolate aaurantiiisolateL082 large subunit ribosomal RNA gene, partial sequence | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 310 | MK630225 | Chrysomphalus aonidum isolate P1_Chr_aonidum_Hap1 large subunit ribosomal RNA gene, partial sequence | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 311 | GQ325448 | Aonidiella citrina isolate D0533A 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 312 | MT677432 | Aonidiella inornata voucher UMEC:D4898D 28S ribosomal RNA gene, partial sequence | 392 | 51.1% | 488.621 | 5.14e-133 | 90.9% |
| 313 | MK636544 | Aonidiella citrina isolate P2_Ao_citrina_Hap1 large subunit ribosomal RNA gene, partial sequence. | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 314 | MK636547 | Aonidiella citrina isolate P2_Ao_citrina_Hap4 large subunit ribosomal RNA gene, partial sequence. | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 315 | DQ145361 | Melanaspis sp. 1 JCA-2010 isolate D264A 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 316 | GQ325541 | Pseudaonidia dentata isolate D2058A 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 317 | DQ145363 | Melanaspis sp. 2 JCA-2010 isolate D275D 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 318 | DQ145362 | Melanaspis sp. 2 JCA-2010 isolate D297A 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 520.337 | 1.46e-142 | 90.9% |
| 319 | MW542045 | Planococcus minor voucher 170121-MY-14A(IN6) large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 924.227 | 0.00e+00 | 90.8% |
| 320 | MK873093 | Planococcus minor voucher LL4 large subunit ribosomal RNA gene, partial sequence | 713 | 93.0% | 882.599 | 0.00e+00 | 90.8% |
| 321 | JQ651366 | Phenacoccus solenopsis voucher ARCPPRI SB264_4 28S ribosomal RNA gene, partial sequence | 678 | 88.4% | 837.007 | 0.00e+00 | 90.8% |
| 322 | JQ651365 | Planococcus citri voucher ARCPPRI SB263_5 28S ribosomal RNA gene, partial sequence | 677 | 88.3% | 835.025 | 0.00e+00 | 90.8% |
| 323 | JQ651364 | Planococcus citri voucher ARCPPRI SB263_3 28S ribosomal RNA gene, partial sequence | 676 | 88.1% | 833.043 | 0.00e+00 | 90.8% |
| 324 | JQ651171 | Planococcus citri voucher ARCPPRI SB32_5 28S ribosomal RNA gene, partial sequence | 673 | 87.7% | 827.096 | 0.00e+00 | 90.8% |
| 325 | KT369512 | Phenacoccus solenopsis voucher Psle005 28S ribosomal RNA gene, partial sequence | 446 | 58.1% | 547.597 | 9.07e-151 | 90.8% |
| 326 | MH248302 | Phenacoccus solenopsis voucher PS12 large subunit ribosomal RNA gene, partial sequence | 445 | 58.0% | 545.614 | 3.58e-150 | 90.8% |
| 327 | MH248338 | Phenacoccus solenopsis voucher S0004D large subunit ribosomal RNA gene, partial sequence | 445 | 58.0% | 545.614 | 3.58e-150 | 90.8% |
| 328 | MH248321 | Phenacoccus solenopsis voucher PS31 large subunit ribosomal RNA gene, partial sequence | 444 | 57.9% | 543.632 | 1.42e-149 | 90.8% |
| 329 | ON787838 | Phenacoccus solenopsis voucher MN 09 large subunit ribosomal RNA gene, partial sequence | 436 | 56.8% | 535.703 | 3.45e-147 | 90.8% |
| 330 | EU188480 | Pseudococcus jackbeardsleyi 28S large subunit ribosomal RNA gene, partial sequence | 292 | 38.1% | 361.264 | 1.12e-94 | 90.8% |
| 331 | JQ651202 | Planococcus ficus voucher ARCPPRI SB138_6 28S ribosomal RNA gene, partial sequence | 677 | 88.3% | 827.096 | 0.00e+00 | 90.7% |
| 332 | JQ651203 | Planococcus ficus voucher ARCPPRI SB138_7 28S ribosomal RNA gene, partial sequence | 676 | 88.1% | 825.113 | 0.00e+00 | 90.7% |
| 333 | JQ651363 | Planococcus citri voucher ARCPPRI SB263_2 28S ribosomal RNA gene, partial sequence | 669 | 87.2% | 819.167 | 0.00e+00 | 90.7% |
| 334 | JX500000 | Paracoccus burnerae voucher ARC-PPRI SB22.1 28S ribosomal RNA gene, partial sequence | 576 | 75.1% | 708.16 | 0.00e+00 | 90.7% |
| 335 | MK873090 | Phenacoccus solani voucher LL1 large subunit ribosomal RNA gene, partial sequence | 460 | 60.0% | 559.49 | 2.38e-154 | 90.7% |
| 336 | MH248300 | Phenacoccus solenopsis voucher PS10 large subunit ribosomal RNA gene, partial sequence | 441 | 57.5% | 537.685 | 8.73e-148 | 90.7% |
| 337 | MH248301 | Phenacoccus solenopsis voucher PS11 large subunit ribosomal RNA gene, partial sequence | 438 | 57.1% | 531.739 | 5.38e-146 | 90.7% |
| 338 | GQ325466 | Clavaspis herculeana isolate D2040B 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 512.408 | 3.55e-140 | 90.7% |
| 339 | DQ145323 | Dynaspidiotus californicus isolate D055A 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 512.408 | 3.55e-140 | 90.7% |
| 340 | GQ325515 | Nuculaspis californica isolate D0026B 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 512.408 | 3.55e-140 | 90.7% |
| 341 | GQ325474 | Diaspidiotus osborni isolate D2176A 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 512.408 | 3.55e-140 | 90.7% |
| 342 | DQ145322 | Dynaspidiotus californicus isolate D026A 28S ribosomal RNA gene, partial sequence | 416 | 54.2% | 512.408 | 3.55e-140 | 90.7% |
| 343 | JX500002 | Paracoccus burnerae voucher ARC-PPRI SB22.3 28S ribosomal RNA gene, partial sequence | 572 | 74.6% | 700.231 | 0.00e+00 | 90.6% |
| 344 | KP692456 | Rastrococcus tropicasiaticus isolate S3-105 28S ribosomal RNA gene, partial sequence | 516 | 67.3% | 625.3971 | 3.44e-174 | 90.6% |
| 345 | KT369514 | Phenacoccus solani voucher Psla003 28S ribosomal RNA gene, partial sequence | 446 | 58.1% | 539.668 | 2.21e-148 | 90.6% |
| 346 | MW542054 | Rastrococcus rubellus voucher 170510-Viet-02(PBZ1) large subunit ribosomal RNA gene, partial sequence | 495 | 64.5% | 603.5917999999999 | 1.26e-167 | 90.6% |
| 347 | GQ325473 | Diaspidiotus gigas isolate D0688A 28S ribosomal RNA gene, partial sequence | 413 | 53.8% | 506.461 | 2.19e-138 | 90.6% |
| 348 | LC278437 | Ferrisia virgata gene for 28S ribosomal RNA, partial sequence | 759 | 99.0% | 908.369 | 0.00e+00 | 90.5% |
| 349 | MW542057 | Rastrococcus sp. 2 JC-2021 voucher 150504-JY-10(IN99) large subunit ribosomal RNA gene, partial sequence | 520 | 67.8% | 631.3438000000001 | 5.58e-176 | 90.5% |
| 350 | MH248341 | Phenacoccus solani voucher S0009A large subunit ribosomal RNA gene, partial sequence | 450 | 58.7% | 539.668 | 2.21e-148 | 90.5% |
| 351 | MH248342 | Phenacoccus solani voucher S0009B large subunit ribosomal RNA gene, partial sequence | 450 | 58.7% | 539.668 | 2.21e-148 | 90.5% |
| 352 | ON497259 | Aonidiella comperei isolate acompereiolateLA116 large subunit ribosomal RNA gene, partial sequence | 416 | 54.2% | 504.479 | 8.65e-138 | 90.5% |
| 353 | OR046673 | Ferrisia virgata isolate FS2-28S large subunit ribosomal RNA gene, partial sequence | 749 | 97.7% | 888.546 | 0.00e+00 | 90.4% |
| 354 | MW542052 | Rastrococcus invadens voucher 170630-IDNS-04(IN27) large subunit ribosomal RNA gene, partial sequence | 521 | 67.9% | 631.3438000000001 | 5.58e-176 | 90.4% |
| 355 | KT369517 | Phenacoccus solani voucher Psla012 28S ribosomal RNA gene, partial sequence | 446 | 58.1% | 531.739 | 5.38e-146 | 90.4% |
| 356 | KY565036 | Anisococcus granarae haplotype 11 28S ribosomal RNA gene, partial sequence | 720 | 93.9% | 868.723 | 0.00e+00 | 90.3% |
| 357 | KP692290 | Ferrisia virgata isolate S3-671 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 868.723 | 0.00e+00 | 90.3% |
| 358 | JX500003 | Paracoccus burnerae voucher ARC-PPRI SB22.4 28S ribosomal RNA gene, partial sequence | 636 | 82.9% | 763.663 | 0.00e+00 | 90.3% |
| 359 | MH248323 | Phenacoccus solenopsis voucher PS35 large subunit ribosomal RNA gene, partial sequence | 422 | 55.0% | 500.022 | 1.90e-136 | 90.3% |
| 360 | KY211338 | Ferrisia virgata isolate M4-004A 28S ribosomal RNA gene, partial sequence | 723 | 94.3% | 846.918 | 0.00e+00 | 90.2% |
| 361 | JQ651164 | Planococcus citri voucher ARCPPRI SB18_2 28S ribosomal RNA gene, partial sequence | 645 | 84.1% | 763.663 | 0.00e+00 | 90.2% |
| 362 | KT369510 | Phenacoccus defectus voucher Pdef001 28S ribosomal RNA gene, partial sequence | 446 | 58.1% | 523.81 | 1.31e-143 | 90.2% |
| 363 | MW542053 | Rastrococcus mangiferae voucher 180527-MY-13(IN98) large subunit ribosomal RNA gene, partial sequence | 520 | 67.8% | 613.5038 | 1.31e-170 | 90.1% |
| 364 | MH248343 | Phenacoccus solani voucher S0009C large subunit ribosomal RNA gene, partial sequence | 434 | 56.6% | 507.951 | 7.80e-139 | 90.1% |
| 365 | MH248345 | Phenacoccus solani voucher S0014A large subunit ribosomal RNA gene, partial sequence | 434 | 56.6% | 507.951 | 7.80e-139 | 90.1% |
| 366 | KY565041 | Ferrisia williamsi haplotype 16 28S ribosomal RNA gene, partial sequence | 637 | 83.1% | 741.858 | 0.00e+00 | 90.0% |
| 367 | JQ651373 | Pseudococcus viburni voucher ARCPPRI SB292_2 28S ribosomal RNA gene, partial sequence | 537 | 70.0% | 634.816 | 5.03e-177 | 90.0% |
| 368 | MW542038 | Phenacoccus madeirensis voucher 180527-MY-05(IN49) large subunit ribosomal RNA gene, partial sequence | 484 | 63.1% | 553.543 | 1.47e-152 | 89.9% |
| 369 | KJ461274 | Phenacoccus solenopsis 28S ribosomal RNA gene, partial sequence | 629 | 82.0% | 718.5630000000001 | 3.10e-202 | 89.8% |
| 370 | KP692453 | Rastrococcus invadens isolate S3-136 28S ribosomal RNA gene, partial sequence | 494 | 64.4% | 573.8586 | 1.13e-158 | 89.8% |
| 371 | MH248314 | Phenacoccus solenopsis voucher PS24 large subunit ribosomal RNA gene, partial sequence | 402 | 52.4% | 460.377 | 1.63e-124 | 89.8% |
| 372 | JX499995 | Ferrisia malvastra voucher ARC-PPRI SB11.7 28S ribosomal RNA gene, partial sequence | 511 | 66.6% | 591.206 | 6.75e-164 | 89.7% |
| 373 | JX499997 | Ferrisia malvastra voucher ARC-PPRI SB11.9 28S ribosomal RNA gene, partial sequence | 508 | 66.2% | 585.26 | 4.17e-162 | 89.6% |
| 374 | MW542051 | Rastrococcus iceryoides voucher 170630-IDNS-05(IN28) large subunit ribosomal RNA gene, partial sequence | 521 | 67.9% | 597.6458 | 7.78e-166 | 89.6% |
| 375 | ON787837 | Rastrococcus mangiferae voucher LG 01 large subunit ribosomal RNA gene, partial sequence | 440 | 57.4% | 503.987 | 1.22e-137 | 89.6% |
| 376 | KP692237 | Ceroputo pilosellae isolate 2510 28S ribosomal RNA gene, partial sequence | 508 | 66.2% | 579.8052 | 1.83e-160 | 89.6% |
| 377 | KP692449 | Rastrococcus invadens isolate S3-106 28S ribosomal RNA gene, partial sequence | 494 | 64.4% | 565.9295999999999 | 2.75e-156 | 89.6% |
| 378 | MH248339 | Phenacoccus solani voucher S0006D large subunit ribosomal RNA gene, partial sequence | 411 | 53.6% | 462.359 | 4.13e-125 | 89.6% |
| 379 | MT123784 | Phenacoccus solenopsis voucher Iraq1 large subunit ribosomal RNA gene, partial sequence | 604 | 78.7% | 669.0070000000001 | 2.57e-187 | 89.4% |
| 380 | KP692381 | Phenacoccus solenopsis isolate S2-243 28S ribosomal RNA gene, partial sequence | 600 | 78.2% | 661.0780000000001 | 6.25e-185 | 89.4% |
| 381 | MW542039 | Phenacoccus parvus voucher 190827-MY-07(IN115) large subunit ribosomal RNA gene, partial sequence | 578 | 75.4% | 647.202 | 9.40e-181 | 89.4% |
| 382 | KP692236 | Ceroputo pilosellae isolate S4-241 28S ribosomal RNA gene, partial sequence | 508 | 66.2% | 571.8761000000001 | 4.45e-158 | 89.4% |
| 383 | MH248351 | Phenacoccus solenopsis voucher S0067A large subunit ribosomal RNA gene, partial sequence | 597 | 77.8% | 655.1306 | 3.86e-183 | 89.3% |
| 384 | MH248346 | Phenacoccus solenopsis voucher S0017A large subunit ribosomal RNA gene, partial sequence | 597 | 77.8% | 655.1306 | 3.86e-183 | 89.3% |
| 385 | MH248358 | Phenacoccus solenopsis voucher S0077A large subunit ribosomal RNA gene, partial sequence | 597 | 77.8% | 655.1306 | 3.86e-183 | 89.3% |
| 386 | MH248350 | Phenacoccus solenopsis voucher S0066A large subunit ribosomal RNA gene, partial sequence | 597 | 77.8% | 655.1306 | 3.86e-183 | 89.3% |
| 387 | MH248357 | Phenacoccus solenopsis voucher S0075A large subunit ribosomal RNA gene, partial sequence | 597 | 77.8% | 655.1306 | 3.86e-183 | 89.3% |
| 388 | MH248352 | Phenacoccus solenopsis voucher S0068A large subunit ribosomal RNA gene, partial sequence | 597 | 77.8% | 655.1306 | 3.86e-183 | 89.3% |
| 389 | MH248355 | Phenacoccus giganteus voucher S0072A large subunit ribosomal RNA gene, partial sequence | 587 | 76.5% | 643.2376 | 1.47e-179 | 89.3% |
| 390 | JQ651255 | Phenacoccus manihoti voucher ARCPPRI SB215_6 28S ribosomal RNA gene, partial sequence | 484 | 63.1% | 535.703 | 3.45e-147 | 89.3% |
| 391 | MW542060 | Ripersiella multiporifera voucher 191213-JY-01(IN117) large subunit ribosomal RNA gene, partial sequence | 538 | 70.1% | 589.7161 | 1.90e-163 | 89.3% |
| 392 | KY211350 | Phenacoccus solenopsis isolate S5-074A 28S ribosomal RNA gene, partial sequence | 589 | 76.8% | 639.273 | 2.29e-178 | 89.2% |
| 393 | MK873094 | Phenacoccus madeirensis voucher LL5 large subunit ribosomal RNA gene, partial sequence | 462 | 60.2% | 503.987 | 1.22e-137 | 89.2% |
| 394 | MH248348 | Phenacoccus solani voucher S0064A large subunit ribosomal RNA gene, partial sequence | 597 | 77.8% | 647.2016 | 9.40e-181 | 89.1% |
| 395 | MH248349 | Phenacoccus solani voucher S0065A large subunit ribosomal RNA gene, partial sequence | 597 | 77.8% | 647.2016 | 9.40e-181 | 89.1% |
| 396 | JX500024 | Phenacoccus madeirensis voucher ARC-PPRI SB132.1 28S ribosomal RNA gene, partial sequence | 456 | 59.5% | 492.093 | 4.63e-134 | 89.1% |
| 397 | MH248347 | Phenacoccus solani voucher S0062A large subunit ribosomal RNA gene, partial sequence | 597 | 77.8% | 639.2726 | 2.29e-178 | 89.0% |
| 398 | MH248340 | Phenacoccus solani voucher S0006E large subunit ribosomal RNA gene, partial sequence | 597 | 77.8% | 639.2726 | 2.29e-178 | 89.0% |
| 399 | KP692378 | Phenacoccus solani isolate S3-810 28S ribosomal RNA gene, partial sequence | 600 | 78.2% | 645.22 | 3.71e-180 | 89.0% |
| 400 | JX499994 | Ferrisia malvastra voucher ARC-PPRI SB11.5 28S ribosomal RNA gene, partial sequence | 470 | 61.3% | 517.863 | 8.10e-142 | 89.0% |
| 401 | KP692366 | Phenacoccus madeirensis isolate S3-154a 28S ribosomal RNA gene, partial sequence | 455 | 59.3% | 490.111 | 1.83e-133 | 89.0% |
| 402 | MH248353 | Phenacoccus solani voucher S0069A large subunit ribosomal RNA gene, partial sequence | 594 | 77.4% | 633.3258000000001 | 1.41e-176 | 88.9% |
| 403 | KP692379 | Phenacoccus solani isolate S4-008 28S ribosomal RNA gene, partial sequence | 600 | 78.2% | 637.291 | 9.05e-178 | 88.9% |
| 404 | JX500027 | Phenacoccus madeirensis voucher ARC-PPRI SB287.2 28S ribosomal RNA gene, partial sequence | 449 | 58.5% | 478.217 | 6.96e-130 | 88.9% |
| 405 | JX499996 | Ferrisia malvastra voucher ARC-PPRI SB11.8 28S ribosomal RNA gene, partial sequence | 459 | 59.8% | 496.058 | 2.97e-135 | 88.8% |
| 406 | KY271371 | Phenacoccus manihoti isolate KZN1 large subunit ribosomal RNA gene, partial sequence | 462 | 60.2% | 492.093 | 4.63e-134 | 88.8% |
| 407 | JQ651370 | Phenacoccus madeirensis voucher ARCPPRI SB287_4 28S ribosomal RNA gene, partial sequence | 447 | 58.3% | 474.253 | 1.09e-128 | 88.8% |
| 408 | JQ651371 | Phenacoccus madeirensis voucher ARCPPRI SB287_5 28S ribosomal RNA gene, partial sequence | 447 | 58.3% | 474.253 | 1.09e-128 | 88.8% |
| 409 | JX500022 | Phenacoccus madeirensis voucher ARC-PPRI SB94.4 28S ribosomal RNA gene, partial sequence | 446 | 58.1% | 472.271 | 4.29e-128 | 88.8% |
| 410 | JQ651369 | Phenacoccus madeirensis voucher ARCPPRI SB287_3 28S ribosomal RNA gene, partial sequence | 446 | 58.1% | 472.271 | 4.29e-128 | 88.8% |
| 411 | LC440345 | Dysmicoccus brevipes EMM5 gene for 28S ribosomal RNA, partial sequence | 331 | 43.2% | 357.299 | 1.75e-93 | 88.7% |
| 412 | ON527955 | Phenacoccus miruku voucher 210626JP03 large subunit ribosomal RNA gene, partial sequence | 632 | 82.4% | 659.095 | 2.47e-184 | 88.6% |
| 413 | MW542036 | Phenacoccus aceris voucher 180516-JY-05(IN34) large subunit ribosomal RNA gene, partial sequence | 483 | 63.0% | 500.022 | 1.90e-136 | 88.5% |
| 414 | MT831015 | Kermicus sp. SBH-2020 isolate HY large subunit ribosomal RNA gene, partial sequence | 763 | 99.5% | 805.291 | 0.00e+00 | 88.4% |
| 415 | MW251837 | Phenacoccus sp. 1 VCPDS voucher ECFA 142 large subunit ribosomal RNA gene, partial sequence | 454 | 59.2% | 466.324 | 2.65e-126 | 88.4% |
| 416 | JX500023 | Phenacoccus madeirensis voucher ARC-PPRI SB94.5 28S ribosomal RNA gene, partial sequence | 431 | 56.2% | 442.537 | 3.83e-119 | 88.4% |
| 417 | KY271372 | Phenacoccus manihoti isolate KZN2 large subunit ribosomal RNA gene, partial sequence | 442 | 57.6% | 452.448 | 3.98e-122 | 88.3% |
| 418 | MW542059 | Rhizoecus amorphophalli voucher 190528-JY-08(EN95A) large subunit ribosomal RNA gene, partial sequence | 578 | 75.4% | 591.698 | 4.80e-164 | 88.2% |
| 419 | JQ651259 | Phenacoccus manihoti voucher ARCPPRI SB215_10 28S ribosomal RNA gene, partial sequence | 441 | 57.5% | 450.466 | 1.57e-121 | 88.2% |
| 420 | MW542061 | Ripersiella sp. 190824-MY-04(IN96A) large subunit ribosomal RNA gene, partial sequence | 577 | 75.2% | 585.7517 | 2.96e-162 | 88.1% |
| 421 | KP692373 | Phenacoccus parvus isolate S3-275 28S ribosomal RNA gene, partial sequence | 603 | 78.6% | 603.592 | 1.26e-167 | 88.1% |
| 422 | JQ651257 | Phenacoccus manihoti voucher ARCPPRI SB215_8 28S ribosomal RNA gene, partial sequence | 435 | 56.7% | 438.572 | 5.98e-118 | 88.1% |
| 423 | KY211348 | Phenacoccus parvus isolate S5-002B 28S ribosomal RNA gene, partial sequence | 592 | 77.2% | 593.681 | 1.22e-164 | 88.0% |
| 424 | KY271370 | Phenacoccus manihoti isolate MP1 large subunit ribosomal RNA gene, partial sequence | 430 | 56.1% | 428.661 | 5.76e-115 | 87.9% |
| 425 | MW542037 | Phenacoccus azaleae voucher 180428-JY-01A(IN32) large subunit ribosomal RNA gene, partial sequence | 476 | 62.1% | 458.395 | 6.45e-124 | 87.7% |
| 426 | KY211344 | Phenacoccus nr. aceris S3-639 28S ribosomal RNA gene, partial sequence | 443 | 57.8% | 420.732 | 1.40e-112 | 87.5% |
| 427 | KY940020 | Phenacoccus aceris isolate S4-323 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 428 | KY939995 | Phenacoccus azaleae isolate S3-426A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 429 | KY939963 | Phenacoccus aceris isolate S3-169 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 430 | KY940016 | Phenacoccus aceris isolate S4-001 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 431 | KY939973 | Phenacoccus aceris isolate S3-173 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 432 | KY939996 | Phenacoccus aceris isolate S3-426N 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 433 | KY940023 | Phenacoccus aceris isolate S6-019A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 434 | KY939981 | Phenacoccus aceris isolate S3-176 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 435 | KY939969 | Phenacoccus aceris isolate S3-170C 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 436 | KY939947 | Phenacoccus aceris isolate S3-149C 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 437 | KP692353 | Phenacoccus nr. aceris 1 XBW-2015 isolate S3-544A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 438 | KY939992 | Phenacoccus aceris isolate S3-423A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 439 | KY939974 | Phenacoccus aceris isolate S3-173A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 440 | KY939970 | Phenacoccus aceris isolate S3-171 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 441 | KP692351 | Phenacoccus nr. aceris 1 XBW-2015 isolate S3-163 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 442 | KY940008 | Phenacoccus aceris isolate S3-544 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 443 | KY940000 | Phenacoccus aceris isolate S3-459 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 444 | KY939977 | Phenacoccus aceris isolate S3-174 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 445 | KY939967 | Phenacoccus aceris isolate S3-170A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 446 | KY939997 | Phenacoccus aceris isolate S3-437 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 447 | KY939964 | Phenacoccus aceris isolate S3-169A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 448 | KY939971 | Phenacoccus aceris isolate S3-172 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 449 | KY940028 | Phenacoccus aceris isolate S6-034 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 450 | KY939978 | Phenacoccus aceris isolate S3-175 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 451 | KY940014 | Phenacoccus aceris isolate S3-639 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 452 | KY939966 | Phenacoccus aceris isolate S3-170 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 453 | KY939968 | Phenacoccus aceris isolate S3-170B 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 454 | KY940027 | Phenacoccus aceris isolate S6-025 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 455 | KY939972 | Phenacoccus aceris isolate S3-172N 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 456 | KY939962 | Phenacoccus aceris isolate S3-167 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 457 | KY940024 | Phenacoccus aceris isolate S6-019B 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 458 | KY939961 | Phenacoccus aceris isolate S3-165 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 459 | KY940031 | Phenacoccus aceris isolate S6-046A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 460 | KY939945 | Phenacoccus aceris isolate S3-149A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 461 | KY940009 | Phenacoccus aceris isolate S3-544A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 462 | KY939965 | Phenacoccus aceris isolate S3-169B 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 463 | KY940015 | Phenacoccus aceris isolate S3-639A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 464 | KY939991 | Phenacoccus aceris isolate S3-423 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 465 | KY940032 | Phenacoccus aceris isolate S6-046B 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 466 | KY939975 | Phenacoccus aceris isolate S3-173B 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 467 | KY939993 | Phenacoccus aceris isolate S3-425 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 468 | KY939976 | Phenacoccus aceris isolate S3-173N 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 469 | KY939948 | Phenacoccus aceris isolate S3-150 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 470 | KY940001 | Phenacoccus aceris isolate S3-460 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 471 | KY939998 | Phenacoccus aceris isolate S3-444 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 472 | KY940017 | Phenacoccus aceris isolate S4-002 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 473 | KY939960 | Phenacoccus aceris isolate S3-163 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 474 | KP692354 | Phenacoccus nr. aceris 1 XBW-2015 isolate S3-639 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 406.856 | 2.11e-108 | 87.3% |
| 475 | KY939951 | Phenacoccus aceris isolate S3-150C 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 410.821 | 1.35e-109 | 87.2% |
| 476 | KY939949 | Phenacoccus aceris isolate S3-150A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 410.821 | 1.35e-109 | 87.2% |
| 477 | KY939953 | Phenacoccus aceris isolate S3-151 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 410.821 | 1.35e-109 | 87.2% |
| 478 | KY939952 | Phenacoccus aceris isolate S3-150D 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 410.821 | 1.35e-109 | 87.2% |
| 479 | KY939950 | Phenacoccus aceris isolate S3-150B 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 410.821 | 1.35e-109 | 87.2% |
| 480 | MW542027 | Maconellicoccus hirsutus voucher 160806-PHI-10(IN73) large subunit ribosomal RNA gene, partial sequence | 760 | 99.1% | 692.302 | 0.00e+00 | 87.1% |
| 481 | KY211356 | Maconellicoccus hirsutus isolate S5-113 28S ribosomal RNA gene, partial sequence | 723 | 94.3% | 666.532 | 0.00e+00 | 87.1% |
| 482 | KP692234 | Ceroputo clematidis isolate 2552 28S ribosomal RNA gene, partial sequence | 590 | 76.9% | 544.1244 | 1.01e-149 | 87.1% |
| 483 | KY940011 | Phenacoccus azaleae isolate S3-546A 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 398.927 | 5.15e-106 | 87.0% |
| 484 | KY940026 | Phenacoccus azaleae isolate S6-023 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 398.927 | 5.15e-106 | 87.0% |
| 485 | KY940012 | Phenacoccus azaleae isolate S3-546B 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 398.927 | 5.15e-106 | 87.0% |
| 486 | KY940021 | Phenacoccus azaleae isolate S5-003 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 390.998 | 1.25e-103 | 86.8% |
| 487 | KY940022 | Phenacoccus azaleae isolate S5-004 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 390.998 | 1.25e-103 | 86.8% |
| 488 | KY939983 | Phenacoccus azaleae isolate S3-177N 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 390.998 | 1.25e-103 | 86.8% |
| 489 | KY939987 | Phenacoccus azaleae isolate S3-357 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 390.998 | 1.25e-103 | 86.8% |
| 490 | KY939988 | Phenacoccus azaleae isolate S3-371N 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 390.998 | 1.25e-103 | 86.8% |
| 491 | KY940029 | Phenacoccus azaleae isolate S6-035 28S ribosomal RNA gene, partial sequence | 436 | 56.8% | 390.998 | 1.25e-103 | 86.8% |
| 492 | KP692349 | Peliococcus shanxiensis isolate S3-636 28S ribosomal RNA gene, partial sequence | 629 | 82.0% | 486.147 | 2.86e-132 | 85.4% |
| 493 | KP692306 | Heliococcus dorsiporosus isolate 2555A 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 523.81 | 1.31e-143 | 84.6% |
| 494 | KP692346 | Peliococcus shanxiensis isolate S3-382a 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 503.987 | 1.22e-137 | 84.3% |
| 495 | KY211335 | Heliococcus dorsiporosus isolate 2564 28S ribosomal RNA gene, partial sequence | 723 | 94.3% | 502.005 | 4.81e-137 | 84.3% |
| 496 | KP692348 | Peliococcus shanxiensis isolate S3-555 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 500.022 | 1.90e-136 | 84.3% |
| 497 | KP692350 | Peliococcus shanxiensis isolate S3-638 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 500.022 | 1.90e-136 | 84.3% |
| 498 | KP692314 | Heliococcus scutellariae isolate 2513 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 500.022 | 1.90e-136 | 84.2% |
| 499 | KP692299 | Heliococcus bohemicus isolate S3-164a 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 488.129 | 7.23e-133 | 84.0% |
| 500 | KP692309 | Heliococcus lishanensis isolate 2532a 28S ribosomal RNA gene, partial sequence | 734 | 95.7% | 476.235 | 2.75e-129 | 83.8% |
Selected alignment
Selected taxonomy
| Kingdom | |
|---|---|
| Phylum | |
| Class | |
| Order | |
| Family | |
| Genus | |
| Species |
This sections shows the taxa of interest (TOI) specified by the sample submitter. Each of these taxa has been cross-referenced against the candidate species to determine if they might match the taxonomic identity of the sample. A blank row indicates a TOI that did not match any candidate species, meaning that it is unlikely that the sample matches that TOI.
| Taxon of interest | Match rank | Match taxon | Match species | Match accession | Match identity | Database coverage | ||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Pseudococcus longispinus | species | Pseudococcus longispinus | Pseudococcus longispinus | KT199048 | 1.0 |
Database coverage of Taxon of Interest Pseudococcus longispinusThis Taxon of Interest has been independently evaluated against the reference database to determine whether sufficient reference data exists to support identification of this taxon. Insufficient coverage can result in that taxon not be correctly identified as the taxonomic identity of the sample (type-II error). For example, if your sample is from Homo sapiens, but there are no Homo sapiens DNA records in the reference database, the analysis will be unable to detect Homo sapiens as the correct taxonomic identity. In the latter case, the analysis will most likely try to assign the closest relative with existing reference data as the taxonomic identity.
Database coverage of Pseudococcus longispinus
Flag 5.1C:
The reference data are likely to be unreliable for this species
0 records
There are 0 sequences in the reference database for Pseudococcus longispinus at the given locus 28S rRNA gene.
Global occurrence records for Pseudococcus longispinus.
Database coverage of species in genus Pseudococcus
Flag 5.2C:
The reference data offers little support for species in this genus
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus 28S rRNA gene Database coverage of species in genus Pseudococcus that occur in country of origin New Zealand
Flag 5.3B:
The reference data offers some support for species in this genus, when we evaluate only species that occur in the sample’s country of origin
/ (%) of sequence records were found in the reference database for:
Number of GenBank records at locus 28S rRNA gene |
This analysis evaluates how many independent sources have contributed to reference sequences for each candidate species. This provides a measure of confidence in the taxonomic annotation of references sequences. A sequence that has been annotated by multiple independent sources is more likely to have a correct taxonomic annotation.
Candidates
Independent sources
Flag 4B:
Reference sequence sources lack diversity and may therefore be unreliable
Reasoning: Matching sequence records for this species have only 1-5 independent sources
(found 4 sources)
4 Independent Sources
The matching reference sequences for this species have been annotated by 4 independent source(s). A source is considered independent if the author list or publication title is distinct.
Source 1
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| KT199048 | False |
Vea,I.M. Grimaldi,D.A. |
Putting scales into evolutionary time: the divergence of major scale insect lineages (Hemiptera) predates the radiation of modern angiosperm hosts | Sci Rep 6, 23487 (2016) |
| KT199048 | False | Vea,I.M. | Direct Submission | Submitted (22-JUN-2015) Division of Invertebrate Zoology, American Museum of Natural History, Central Park West @ 79th street, New York, NY 10024, USA |
Source 2
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| JQ651177 | False |
Sethusa,M.T. van der Bank,M. van der Bank,H.F. Millar,I.M. |
DNA barcoding scale insects of economic importance in South Africa | Unpublished |
| JQ651177 | False |
Sethusa,M.T. van der Bank,M. van der Bank,H.F. Millar,I.M. |
Direct Submission | Submitted (08-FEB-2012) Zoology, University of Johannesburg, 266 Wonderpark Estate, First Avenue, Karen Park, Pretoria, Gauteng 0181, South Africa |
| JQ651179 | False |
Sethusa,M.T. van der Bank,M. van der Bank,H.F. Millar,I.M. |
DNA barcoding scale insects of economic importance in South Africa | Unpublished |
| JQ651179 | False |
Sethusa,M.T. van der Bank,M. van der Bank,H.F. Millar,I.M. |
Direct Submission | Submitted (08-FEB-2012) Zoology, University of Johannesburg, 266 Wonderpark Estate, First Avenue, Karen Park, Pretoria, Gauteng 0181, South Africa |
| JQ651176 | False |
Sethusa,M.T. van der Bank,M. van der Bank,H.F. Millar,I.M. |
DNA barcoding scale insects of economic importance in South Africa | Unpublished |
| JQ651176 | False |
Sethusa,M.T. van der Bank,M. van der Bank,H.F. Millar,I.M. |
Direct Submission | Submitted (08-FEB-2012) Zoology, University of Johannesburg, 266 Wonderpark Estate, First Avenue, Karen Park, Pretoria, Gauteng 0181, South Africa |
| JQ651178 | False |
Sethusa,M.T. van der Bank,M. van der Bank,H.F. Millar,I.M. |
DNA barcoding scale insects of economic importance in South Africa | Unpublished |
| JQ651178 | False |
Sethusa,M.T. van der Bank,M. van der Bank,H.F. Millar,I.M. |
Direct Submission | Submitted (08-FEB-2012) Zoology, University of Johannesburg, 266 Wonderpark Estate, First Avenue, Karen Park, Pretoria, Gauteng 0181, South Africa |
| Show Hide 6 more publications... | ||||
Source 3
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| KY565034 | False |
Pacheco da Silva,V.C. Kaydan,M.B. Malausa,T. Germain,J.F. Palero,F. Botton,M. |
Integrative taxonomy methods reveal high mealybug (Hemiptera: Pseudococcidae) diversity in southern Brazilian fruit crops | Sci Rep 7 (1), 15741 (2017) |
| KY565034 | False |
Pacheco da Silva,V.C. Kaydan,M.B. Malausa,T. Germain,J.F. Palero,F. Botton,M. |
Direct Submission | Submitted (31-JAN-2017) Entomologia, Embrapa Uva e Vinho, Livramento, 515, Bento Goncalves, RS 95700000, Brazil |
Source 4
| Hit accession | Automated | Authors | Title | Journal |
|---|---|---|---|---|
| KP692428 | False |
Wang,X.-B. Zhang,J.-T. Deng,J. Zhou,Q.-S. Zhang,Y.-Z. Wu,S.-A. |
DNA barcoding of mealybugs in mainland China | Unpublished |
| KP692428 | False |
Wang,X.-B. Zhang,J.-T. Deng,J. Zhou,Q.-S. Zhang,Y.-Z. Wu,S.-A. |
Direct Submission | Submitted (22-JAN-2015) Key Laboratory for Silviculture and Conservation of Ministry of Education, Beijing Forestry University, No. 35 Tsinghua East Road, Haidian District, Beijing 100083, China |
This section provides a phylogeny of the candidate reference sequences. The analyst can use this to make a subjective observation on how well the reference sequences are able to distinguish between species. If the phylogeny shows distinct clades for each species, we can be confident that the molecular data are capable of distinguishing between those species. However, if the phylogeny shows overlap between species, this reduces the capacity of the molecular data to confidently distinguish between those species. In some cases, we may see the query sequence falling outside of the adjacent species' clades, which indicates that our query species is not represented in the reference database, which could indicate a rare or novel species.
The following resources can be used to ensure that the given taxonomy is legitimate and current.
| Taxa | Database |
|---|---|
| General | GBIF |
| General | ITIS |
| Mealybugs & scale | ScaleNet database |
| Thrips | Thripswiki |
| Spider Mites | Spider Mites Database |
| Psocodea (Barklice, Booklice, and Parasitic Lice) | Psocodea Species File Online |
| Orthoptera | Orthoptera Species File Online |
| Drosophilidae | TaxoDros |
| Diptera |
Catalog of the Diptera of the Australasian and Oceanian Regions
Systema Dipterorum |
| Aphids | Aphid Species File |
| Ants |
AntWeb
AntCat |
| Lepidoptera (butterflies and moths) | The Global Lepidoptera Names Index |
| Gracillariidae (primitive moths) | Global Taxonomic Database of Gracillariidae |
| Pyralidae (pyralid moths) | Global Information System on Pyraloidea |
| Tortricidae (tortrix moths) | Tortricidae Resources on the Net |